Research
Request for Proposals
  |  Research Reports

DOT Project Number:  90-00-LRTF-515

Fiscal Year:  2005

Award:  $19,175.00

Principal Investigator:  Dr. James Jurgenson, Department of Biology, University of Northern Iowa, James.Jurgenson@uni.edu

Other Project Participants:  Zach Regelin, John Holding, and Lauren Alsager, Department of Biology, University of Northern Iowa

Summary Report:

Analysis of populations of Panicum virgatum using Fluorescent AFLP analysis and identification of micro-satellite markers to distinguish cultivated from native switch grass.

Amplified Fragment Length Polymorphism (AFLP) was applied to Panicum virgatum DNA in an attempt to identify micro-satellite markers. In theory, these markers could be useful to discriminate Panicum virgatum (switch grass) native to Iowa from commercially bred varieties developed for forage and widely planted in the state. Samples were collected from several locations in Iowa including the Neil Smith Wildlife Refuge.   DNA was extracted from the samples and first analyzed using Fluorescent AFLP and electrophoretic separation on the Beckman CEQ 8000 Genetic Analyzer.  This analysis showed and confirmed earlier observations that none of the samples collected from the field exhibited DNA fragment patterns similar to that obtained by analysis of DNA extracted from commercial cultivar strains of Panicum virgatum.  The typical analysis of DNA with the AFLP technique involves digestion of the DNA samples restriction enzymes, modification of the digested DNA with synthetic end fragments called adapters and a  selective PCR amplification of restriction fragments with primers complementary to the enzyme cut sites.  This process costs about $30/ sample.

Because of the cost of analysis of samples using fluorescent AFLP we have been developing a more sensitive assay based on simple repeated DNA sequences called micro-satellites. To identify and characterize micro-satellite sequences in Panicum virgatum a modified version of the AFLP technique was used. The modified form required both restriction fragment primers as well as simple sequence repeat (SSR) primers to amplify only fragments flanked by the restriction enzyme cut site and the repeated sequence. AFLP reactions were performed on primer pairs matched from sixteen radioactively labeled EcoR1 plus dinucleotide adapter primers, twenty seven radio labeled Mse1 plus di- and trinucleotide adapter primers and thirty one SSR primers. Amplified fragments were visualized on polyacrylamide gels and examined for polymorphisms, indicated by a series of bands within only a few nucleotides of one another, called stutter bands. These identified loci did not develop into useful markers. Lee E. Gunter, Ecosystem and Plant Sciences Group, Environmental Sciences Division, Oak Ridge National Laboratory, communicated to us that she had developed micro-satellites for cultivars of switchgrass in a previous study.  We utilized ten of these loci to analyze the samples from the Neal Smith National Wildlife Reserve.

Introduction:

In this research we analyzed the populations of switch grass from the Neal Smith preserve with our current fluorescent AFLP analysis in order to determine the native or cultivar origin of these populations. Because this analysis is so expensive we further developed microsatellite PCR loci which would be specific to the analysis of switch grass populations.  This analysis was at the request of Pauline Drobney who was trying to determine if some of her populations of switch grass were of native or commercial cultivar origin.  In the fall of 2004 mature bundles of switchgrass were delivered to the laboratory at UNI.   The samples were identified in the following manner:

1.  Plantings in parking lot plantings (PLC2). 2. Planting surrounding the Prairie Learning Center (PLC).  3.  Planting Site 10 (S10) from Harker Prairie in Story County.   4. Maminka Prairie(MAM).  5. NRCS adjacency (WL).  6. Roman's Lake (RL).  7.  Badger Digs ( CF):  remnant prairie on Neal Smith NWR.  DNA from plants collected at these sites were compared to each other and to the DNA extracted from plants of commercial cultivars of switchgrass.  Commercial cultivars used previously and in this analysis are :  A (Alamo), B (Blackwell), CR (Cave-In-Rock), F (Forestburg), K (Kanlow), and P (Pathfinder). (Hilker 2002)

Materials and methods:

Up to 15 of the youngest shoots were obtained from each sample of grass. DNA was extracted from tissue that had been dried on silica gel and ground to a fine powder in a mortor and pestle and stored in the freezer.

DNA Extraction:

DNA was extracted from tissue samples using a modified diatomaceous earth protocol (Boom et al., 1990).  Approximately 5-175 mg of powdered tissue was combined with    900 µl of Extraction Buffer (2% CTAB extraction buffer [100millimolar (mM) Tris-HCl (tris hydroxymethyl aminomethane) pH 8.0, 2% (w/v) CTAB (Fisher Scientific), 20mM ethylenediamine tetraacetic acid (EDTA) (Matheson Coleman & Bell) pH 8.0, 1.4 M NaCl (Fisher Scientific), 0.5% (w/v) sodium bisulfite (General Chemical Company), 0.5% (v/v) beta-mercaptoethanol (National Diagnostics)) in a 1.5 ml microcentrifuge tube.  After incubation for 1 hour in a 60°C water bath, shaking every 15 minutes, enough Sevag (~500 µl);(Chloroform : isoamyl alcohol; 24:1) was added to fill the tube and vortexed to emulsify the mixture.  After centrifugation, the aqueous layer was reserved and thoroughly mixed with 875 µl of Adsorption Buffer (7.0 M guanidine thiocyanate, 100 mM Tris-HC1 ph 6.5, 5 mM EDTA, and 1.8% (w/v) diatomaceous earth).  This mixture was incubated at room temperature for 20-30 minutes with occasional mixing.  Then the tube was centrifuged 13,000 RPM at high speed for approximately 30 seconds and the supernatant was discarded.  The pellet was gently resuspended in Guanidine Wash Buffer (80 mM K acet, 8.4 mM Tris-HC1, 40 µM EDTA, 55% ethanol ph 7.4) and centrifuged to remove trace amounts of the supernatant.  Once the Wash Buffer was removed the tube was inverted so that the pellet could dry at room temperature for 15 minutes.  After suspension in 67 µl of 1X TE buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0) the pellet was incubated at 65°C for 30 minutes with occasional mixing.  The diatomacious earth was pelleted by centrifugation for one minute.  The DNA-containing supernatant was transferred to a new tube.  The remaining pellet was suspended in 33 µl of 1x TE buffer and incubated at 70°C for 30 minutes.  The supernatant from this step was combined with the first to produce 100 µl of DNA extract.

The extracted DNA was quantitated by electrophoresis on a 0.7% agarose gel containing ethidium bromide with Lambda Hind III digested DNA used as a mass standard.  The concentration of each plant DNA sample was determined by measuring the fluorescence of the bands of plant DNA compared to Lambda Hind III DNA fragments.  Digital images of gels were taken using a COHU high performance CCD camera connected to a Macintosh Quadra 840av and NIH Image capturing program.  Kodak 1D software was used to analyze the digital images of the gels.   The concentrations of the plant DNA samples were then recorded in ng/µl of DNA.

AFLP analysis:

The DNA isolated from all samples were analyzed by fluorescent AFLP on the Beckman CEQ 8000 genetic analyzer using the following series of steps:

Digestion:
The AFLP process was adapted from Soltis (2002) with minor modifications.  DNA sample concentration was adjusted to 100 ng of DNA in 8 µl with water.  To each 8 µl sample, 1 µl of 10X OPA (500 mM Potassium Acetate, 100 mM Magnesium Acetate, 100 mM Tris Acetate pH 7.5) was mixed with  1 µl of a restriction enzyme digest mixture containing 1 unit each of EcoRI and MSE I restriction enzymes.  The DNA samples were then incubated at 37°C for 1 hour.  After digestion, 10 ul of a ligation mix containing 1x NEB ligation buffer, 1x OPA restriction digest buffer, 0.4 microliter of the 5 pm/ul stocks of the EcoR1adapter, 0.4 microliter of the 50 pm/ul stocks of the Mse 1 adapter, and one weiss unit (67 NEB units) of T4 DNA ligase was added and incubated at 20 °C overnight.  This produces restriction fragments  modified by addition of synthetic DNA adapters to the ends with DNA ligase.  Adapters used above were prepared  by combining Eco RI oligo 1 (5’CTC GTA GAC TGC CTA CC3’) and oligo 2 (5’AAT TGG TAC GCA GTC3’) at 5 µM each.  Mse I oligo 3 (5’GAC GAT GAG TCC TGA G3’) and oligo 4 (5’TAC TCA GGA CTC AT3’) were also combined but at 50 µM each.  Both oligo mixtures were then heated in the Biometra T Gradient Thermocycler to 94°C and slowly cooled to room temperature.

Preamplification:
The ligation mixture was diluted with 4 volumes of 1X TE buffer.  A preamplification cocktail was prepared (0.41 ul of 100 mM dNTPs (25 mM each ;A,C,G,T), 1.3   ul of a 50 ng/ul stock of the EcoR1 adapter primer (5’ CTC GTA GAC TGC GTA CCA ATT CA3') , 1.3   ul of a 50 ng/ul stock of the Mse1 adapter primer (5’ GAC GAT GAG TCC TGA GTA AC 3’), 5.1 ul of 10X AFLP buffer (500 mM KCl, 100 mM Tris-HCl pH 9.0 @ 25C, 15 mM MgCl2), 0.14 ul of Taq (~7 units /ul), 37.75 ul of H2O) and 46 ul added to 5 ul diluted ligation mixture. DNA fragments were amplified by PCR using the following program: 70 °C for 2 minutes, 94°C for 30 seconds, 56°C for 30 seconds, 72°C for 2 minutes, return to step two 19 times, then  60°C for 30 minutes, and ending in a 4°C hold.

AFLP Amplification:
For AFLP analysis preamplified DNA was diluted 1:20 with 1X TE buffer, 5.0 ul was combined with an AFLP cocktail (0.5 ul formamide, 2.5 ul 10X AFLP Buffer, 0.3 ul 100 mM dNTP's , 5 pmole  Wellred dye™ (Beckman-Coulter) Labeled EcoRI specific primer, 25pmole MSE 1 primer, 0.25 ul Taq, 15.35 ul water).  The primer sequences (Eco RI primer: 5’AGA CTG CGT ACC AAT TCAXX 3’) (Mse I primer: 5’GAT GAG TCC TGA GTA ACXX3”) used for amplification contain the one base extension just as the preamplification primer as well as a two base extension that is specified by the user.  The preamplified DNA was selectively amplified by the following program: 94°C for 2 minutes, 94°C 30 sec, 65°C for 30 seconds reducing by 1°C per cycle, 72°C for 2 minutes, return to step 2 for 9 more times, 94°C for 30 seconds, 72°C for 2 minutes, return to step 6 for 35 more times, 60°C for 30 minutes, and 4°C hold.

The AFLP amplification selects for fragments that contain specified bases next to the restriction site sequence.  For example, bases that contain 5’ACC3’ on the Eco RI side of the fragment and 5’CCT3’ on the Mse I side of the fragment will be amplified.  This step further reduces the number of fragments visualized during capillary gel electrophoresis.  The preamplification and AFLP amplification step are performed separately to increase the selectivity of the primers.  In the studies by Vos et al., 1995, the amount of background smears was decreased in the fingerprint patterns, and bands were absent when the preamplification step was dismissed.  These bands were otherwise present when both the preamplification and the AFLP amplification were performed.  It was also found that primers with a three base extension show a decreased amount of base mismatching by the sequence adjacent to the restriction site during PCR in comparison to using four base extension primers. (Vos et al., 1995). 

Preparation of samples for fragment detection:
The AFLP amplified DNA was diluted 1:10 in water and 2 ul was transferred to a well in a sample plate along with a 23 ul of a mixture containing formamide (23 ul) and a 600 base pair dye labeled Size Standard (0.2 ul).  A drop of mineral oil was added to the top of each sample.  Another tray was filled with 1.1 X ACE Separation Buffer that corresponded with the filled wells in the sample plate. 

Fragment Analysis:

The samples were run on the Beckman CEQ 8000 Genetic Analysis System and analyzed with the AFLP analysis software.  The CEQ computer software analyzes the fragments by detecting the length in comparison to a 600 base pair size standard, and assigns a “1” if the fragment is present or a “0” if the fragment is absent.  Data generated from all primer pair analysis were combined and transferred to McClade 3.06 for formatting and editing. The genetic structure of all populations were determines by analysis with PAUP (Swofford, 2002).  Parsimony analysis was performed using PAUP with 100 heuristic searches, each with random input order to produce the shortest tree.

Micro-satellite analysis

Unmodified DNA isolated from each individual plant was used in a standard PCR reaction using primers specific for each PVSSR locus used in this study.  PCR optimization reactions were performed to determine the optimal annealing temperature of each of the PCR reactions.  A standard 25 ul assay was developed which contained 50 mM KCl, 10mM Tris-HCl pH 9.0 @ 25C, 1.5 mM MgCl2, 200 um dNTPs, 0.5 um each primer, 100 ng of DNA template, and  1 unit of taq DNA polymerase.  Samples were placed in a 200 ul well of a 96 x 200 ul PCR plate.  PCR plates were covered with adhesive film and amplified in a Biometra T Gradient Thermocycler with heated lid.  The amplification program used for all primer pairs was 94 C for 1 min, 56 C for 2 min, and 72 C for 2 min.  This cycle was repeated for 29 more cycles followed by an extension of 72 C for 5 min.  DNA amplification products were analyzed on 1.5 % agarose gels containing ethidium bromide with a 100 BP ladder (neb) used as a molecular weight standard.  Digital images of gels were taken using a COHU high performance CCD camera connected to a Macintosh Quadra 840av and NIH Image capturing program.  Kodak 1D software was used to analyze the digital images of the gels.  

Results

AFLP Analysis

94 DNA samples including 5 samples of DNA isolated from individual plants of the commercial cultivars A (Alamo), B (Blackwell), CR (Cave-In-Rock), F (Forestburg), K (Kanlow), and P (Pathfinder) as well as samples from seven locations of populations derived from the Neal Smith National Wildlife Refuge were simultaneously analyzed By AFLP analysis.  Two different primer pairs EAAAMCCC and EAAAMCGC were used on these templates and fragments collected.  For the EAAAMCCC 249 characters (DNA fragments ranging in size from 60 to 680 base pairs) were recorded.  This data was exported to excel and formatted with McClade and analyzed using Paup© phylogenetic software.  A phylogentic tree derived from these data is presented in figure1.

Figure 1.  Phylogenetic analysis of switchgrass populations from the Neal Smith National Wildlife Reserve  and commercial cultivars.  The samples were identified in the following manner:

PLC2 - Plantings in parking lot plantings, PLC - Prairie Learning Center,  S10 - Planting Site 10, MAM - Maminka Prairie, WL - NRCS adjacency,  RL - Roman's Lake,  CF - Badger Digs,   A (Alamo), B (Blackwell), CR (Cave-In-Rock), F (Forestburg), K (Kanlow), and P (Pathfinder)

From this data it can be seen that there are a few individuals of the plants collected at the NSNWR that are closely related to one of the commercial cultivars. However most individuals cluster with the group that they are derived. 

Micro-satellite characterization:

Primers which amplify ten microsattelite loci were used to characterize individual plants collected from the NSNWR.   A list of the loci, the primer sequences used to amplify the loci, the DNA repeat motif, and the size of the fragment most often amplified by the primers listed are found in Table 1.

Table 1  PVSSR loci used in this study

Locus Primer sequences Repeat motif Most common fragment
PVSSR018

GTGAACTCGGTTGGACCCTA
GGCCCTTCTCCTTTGGTTT

[CAT]5   189
PVSSR026

GCCCAAAAGAATTGAACCAA
CGGGAGAACTACATGCAGAC

[CCG]5 199
PVSSR051

GAGATCGATCGGGAGTGAGA       GGGACGAAGAAGAGCTTGAG

[TTC]4 193
PVSSR064

CGTCTACCGGTAATCGAAGG       ATAACGGCTGGCACTGAAAG

[GC]4* 209
PVSSR083

ACGCCCATCACATTCACAT         CGTGCTCAGTGCTTAATGCT

[AG]4 230
PVSSR084

GCCTGTTCAAGTACCCGTTC         AACCAGAGGAAGACGAAGCA

[GC]4* 229
PVSSR090

TGGTTTTCCTCGCGTACTCT          CTCTCTCACACACACGCACA

[CGTG]6 197
PVSSR091

TTGCGGTTTTCCGGTTATTA         AGTCGCGGAGAGTAGCAGAA

[CTA]4 212
PVSSR103

AGGAATCGGATGTGAAGCTG       ACTGATGGCGCCTTGGAC

[CGG]5 265
PVSSR107

GCTGCAGGTGACCTACGTG           TACCAGCAGACGACGAAGC

[GCT]5 217

Usually one expects to amplify fragments that are about the size of the cloned sequences originally characterized.  However we observed a great deal of variation in the amplification patterns provided by these ten primer pairs when applied to the switchgrass samples of the NSNWR.  The most common alleles were about the size expected but the PCR amplifications quite unexpectedly produced DNA products that were much larger from many DNA samples.  Table 2 lists the loci characterized and the most frequently observed fragments produced by PCR.

Table 2  Most common PCR products produced from NSNWR Switchgrass samples

Locus PCR band sizes produced (in Base Pairs)
Pvssr 18 193, 220, 250,300, 322,  471, 630 900
Pvssr 26 227, 245, 254, 300 , 390, 437, 640
Pvssr 51 106, 220, 250, 300, 340, 400,450,470
Pvssr 64 190,  200, 250, 320, 387, 480
Pvssr 83 216, 225, 233, 260, 275, 311,337, 550, 600
Pvssr 84 107, 254, 280, 380, 462, 640, 960
Pvssr 90 126, 143, 200, 220, 242, 260, 290, 311, 344, 440, 550, 650, 760, 800
Pvssr 91 220, 230, 240 ,337, 442, 450, 560, 680, 850, 1100, 1471
Pvssr 103

128, 135, 142, 150, 157, 250, 271, 281, 377,  400, 500,  933

Pvssr 107 93, 193, 200, 233, 244, 277, 289, 300, 433, 450, 550, 700, 750, 800, 933,1245, 1698

Although not listed here many individual plant DNA samples could be distinguished by the amplification patterns provided by these 10 loci.  Many of the DNA samples however gave no amplification product so it is not possible to do a definitive identification at this time using these primers.  The lack of amplification of samples is probably due to the low concentration of the templates from these samples.  DNA of better quality can be obtained from new sprouts than from mature seed bearing plants as were provided for this study.

Discussion

DNA was isolated from individual plants from seven locations on or near the Neal Smith National Wildlife Refuge.  The genetic diversity of these samples was assessed by Fluorescent AFLP analysis and by micro-satellite analysis using loci previously characterized by Lee Gunter.  AFLP analysis of the refuge grown samples was compared directly to commercial cultivar genomes.  Micro-satellite analysis of the cultivar DNA was not done due to the lack of sufficient quantity of template DNA. Aflp analysis is useful for determining genetic relatedness of populations and can be used with small amounts of DNA.  Once templates are made a number of analysis on the samples can be run.  Micro-satellites on the other hand produce unique fragments from nearly every plant analyzed but requires more DNA to do the analysis.  It is possible that the micro-satellite loci can be used to forensically type individual plants.  This ability would be useful in the study of the vegetative propagation of clonal species.

LITERATURE CITED:

Boom, R. et al.  (1990)  Rapid and simple methods for purification of nucleic acids. Journal of Clinical Microbiology.  28 (3): 495-503.

Hilker, C. A. (2002) The use of AFLP to detect Genetic Differentiation within and among populations of Two Prairie Plant Species: Panicum virgatum and Coreopsis Palmata. M.S. thesis University of Northern Iowa 122 pp.

Soltis and Gitzendamner, M. (2002) Soltis Lab AFLP Protocol. 

Swofford, D.L.  2002.  PAUP*.  Phylogenetic Analysis Using Parsimony (*and Other Methods). 

Version 4.0b 10.  Sinauer Associates, Sunderland, Massachusetts. 

Vos, Pieter, et al.  (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research 23(21), 4407-441).