| |
Research Request
for Proposals |
Research Reports
DOT Project Number: 90-00-LRTF-515
Fiscal Year: 2005
Award: $19,175.00
Principal Investigator: Dr. James Jurgenson, Department of Biology, University of Northern
Iowa, James.Jurgenson@uni.edu
Other Project Participants:
Zach
Regelin, John Holding, and Lauren Alsager, Department of
Biology, University of Northern Iowa
Summary Report:
Analysis of populations of Panicum
virgatum using Fluorescent AFLP analysis and
identification of micro-satellite markers to distinguish
cultivated from native switch grass.
Amplified Fragment Length Polymorphism (AFLP) was
applied to Panicum virgatum DNA in an attempt to
identify micro-satellite markers. In theory, these
markers could be useful to discriminate Panicum
virgatum (switch grass) native to Iowa from
commercially bred varieties developed for forage and
widely planted in the state. Samples were collected from
several locations in Iowa including the Neil Smith
Wildlife Refuge. DNA was extracted from the samples
and first analyzed using Fluorescent AFLP and
electrophoretic separation on the Beckman CEQ 8000
Genetic Analyzer. This analysis showed and confirmed
earlier observations that none of the samples collected
from the field exhibited DNA fragment patterns similar
to that obtained by analysis of DNA extracted from
commercial cultivar strains of Panicum virgatum.
The typical analysis of DNA with the AFLP technique
involves digestion of the DNA samples restriction
enzymes, modification of the digested DNA with synthetic
end fragments called adapters and a selective PCR
amplification of restriction fragments with primers
complementary to the enzyme cut sites. This process
costs about $30/ sample.
Because of the cost of analysis of samples using
fluorescent AFLP we have been developing a more
sensitive assay based on simple repeated DNA sequences
called micro-satellites. To identify and characterize
micro-satellite sequences in Panicum virgatum a
modified version of the AFLP technique was used. The
modified form required both restriction fragment primers
as well as simple sequence repeat (SSR) primers to
amplify only fragments flanked by the restriction enzyme
cut site and the repeated sequence. AFLP reactions were
performed on primer pairs matched from sixteen
radioactively labeled EcoR1 plus dinucleotide adapter
primers, twenty seven radio labeled Mse1 plus di- and
trinucleotide adapter primers and thirty one SSR
primers. Amplified fragments were visualized on
polyacrylamide gels and examined for polymorphisms,
indicated by a series of bands within only a few
nucleotides of one another, called stutter bands. These
identified loci did not develop into useful markers. Lee
E. Gunter, Ecosystem and Plant Sciences Group,
Environmental Sciences Division, Oak Ridge National
Laboratory, communicated to us that she had developed
micro-satellites for cultivars of switchgrass in a
previous study. We utilized ten of these loci to
analyze the samples from the Neal Smith National
Wildlife Reserve.
Introduction:
In
this research we analyzed the populations of switch
grass from the Neal Smith preserve with our current
fluorescent AFLP analysis in order to determine the
native or cultivar origin of these populations. Because
this analysis is so expensive we further developed
microsatellite PCR loci which would be specific to the
analysis of switch grass populations. This analysis was
at the request of Pauline Drobney who was trying to
determine if some of her populations of switch grass
were of native or commercial cultivar origin. In the
fall of 2004 mature bundles of switchgrass were
delivered to the laboratory at UNI. The samples were
identified in the following manner:
1.
Plantings in parking lot plantings (PLC2). 2. Planting
surrounding the Prairie Learning Center (PLC). 3.
Planting Site 10 (S10) from Harker Prairie in Story
County. 4. Maminka Prairie(MAM). 5. NRCS adjacency (WL).
6. Roman's Lake (RL). 7. Badger Digs ( CF): remnant
prairie on Neal Smith NWR. DNA from plants collected at
these sites were compared to each other and to the DNA
extracted from plants of commercial cultivars of
switchgrass. Commercial cultivars used previously and
in this analysis are : A (Alamo), B (Blackwell), CR
(Cave-In-Rock), F (Forestburg), K (Kanlow), and P
(Pathfinder). (Hilker 2002)
Materials and methods:
Up
to 15 of the youngest shoots were obtained from each
sample of grass. DNA was extracted from tissue that had
been dried on silica gel and ground to a fine powder in
a mortor and pestle and stored in the freezer.
DNA
Extraction:
DNA
was extracted from tissue samples using a modified
diatomaceous earth protocol (Boom et al., 1990).
Approximately 5-175 mg of powdered tissue was combined
with 900 µl of Extraction Buffer (2% CTAB extraction
buffer [100millimolar (mM) Tris-HCl (tris hydroxymethyl
aminomethane) pH 8.0, 2% (w/v) CTAB (Fisher Scientific),
20mM ethylenediamine tetraacetic acid (EDTA) (Matheson
Coleman & Bell) pH 8.0, 1.4 M NaCl (Fisher Scientific),
0.5% (w/v) sodium bisulfite (General Chemical Company),
0.5% (v/v) beta-mercaptoethanol (National Diagnostics))
in a 1.5 ml microcentrifuge tube. After incubation for
1 hour in a 60°C water bath, shaking every 15 minutes,
enough Sevag (~500 µl);(Chloroform : isoamyl alcohol;
24:1) was added to fill the tube and vortexed to
emulsify the mixture. After centrifugation, the aqueous
layer was reserved and thoroughly mixed with 875 µl of
Adsorption Buffer (7.0 M guanidine thiocyanate, 100 mM
Tris-HC1 ph 6.5, 5 mM EDTA, and 1.8% (w/v) diatomaceous
earth). This mixture was incubated at room temperature
for 20-30 minutes with occasional mixing. Then the tube
was centrifuged 13,000 RPM at high speed for
approximately 30 seconds and the supernatant was
discarded. The pellet was gently resuspended in
Guanidine Wash Buffer (80 mM K acet, 8.4 mM Tris-HC1, 40
µM EDTA, 55% ethanol ph 7.4) and centrifuged to remove
trace amounts of the supernatant. Once the Wash Buffer
was removed the tube was inverted so that the pellet
could dry at room temperature for 15 minutes. After
suspension in 67 µl of 1X TE buffer (10 mM Tris-HCl, 0.1
mM EDTA, pH 8.0) the pellet was incubated at 65°C for 30
minutes with occasional mixing. The diatomacious earth
was pelleted by centrifugation for one minute. The
DNA-containing supernatant was transferred to a new
tube. The remaining pellet was suspended in 33 µl of 1x
TE buffer and incubated at 70°C for 30 minutes. The
supernatant from this step was combined with the first
to produce 100 µl of DNA extract.
The extracted DNA was quantitated by electrophoresis on
a 0.7% agarose gel containing ethidium bromide with
Lambda Hind III digested DNA used as a mass standard.
The concentration of each plant DNA sample was
determined by measuring the fluorescence of the bands of
plant DNA compared to Lambda Hind III DNA
fragments. Digital images of gels were taken using a
COHU high performance CCD camera connected to a
Macintosh Quadra 840av and NIH Image capturing program.
Kodak 1D software was used to analyze the digital images
of the gels. The concentrations of the plant DNA
samples were then recorded in ng/µl of DNA.
AFLP
analysis:
The
DNA isolated from all samples were analyzed by
fluorescent AFLP on the Beckman CEQ 8000 genetic
analyzer using the following series of steps:
Digestion:
The AFLP process was adapted from Soltis (2002) with
minor modifications. DNA sample concentration was
adjusted to 100 ng of DNA in 8 µl with water. To each 8
µl sample, 1 µl of 10X OPA (500 mM Potassium Acetate,
100 mM Magnesium Acetate, 100 mM Tris Acetate pH 7.5)
was mixed with 1 µl of a restriction enzyme digest
mixture containing 1 unit each of EcoRI and MSE I
restriction enzymes. The DNA samples were then
incubated at 37°C for 1 hour. After digestion, 10 ul of
a ligation mix containing 1x NEB ligation buffer, 1x OPA
restriction digest buffer, 0.4 microliter of the 5 pm/ul
stocks of the EcoR1adapter, 0.4 microliter of the 50 pm/ul
stocks of the Mse 1 adapter, and one weiss unit (67 NEB
units) of T4 DNA ligase was added and incubated at 20 °C
overnight. This produces restriction fragments
modified by addition of synthetic DNA adapters to the
ends with DNA ligase. Adapters used above were
prepared by combining Eco RI oligo 1 (5’CTC GTA
GAC TGC CTA CC3’) and oligo 2 (5’AAT TGG TAC GCA GTC3’)
at 5 µM each. Mse I oligo 3 (5’GAC GAT GAG TCC
TGA G3’) and oligo 4 (5’TAC TCA GGA CTC AT3’) were also
combined but at 50 µM each. Both oligo mixtures were
then heated in the Biometra T Gradient Thermocycler to
94°C and slowly cooled to room temperature.
Preamplification:
The
ligation mixture was diluted with 4 volumes of 1X TE
buffer. A preamplification cocktail was prepared (0.41
ul of 100 mM dNTPs (25 mM each ;A,C,G,T), 1.3 ul of a
50 ng/ul stock of the EcoR1 adapter primer (5’ CTC GTA
GAC TGC GTA CCA ATT CA3') , 1.3 ul of a 50 ng/ul stock
of the Mse1 adapter primer (5’ GAC GAT GAG TCC TGA GTA
AC 3’), 5.1 ul of 10X AFLP buffer (500 mM KCl, 100 mM
Tris-HCl pH 9.0 @ 25C, 15 mM MgCl2), 0.14 ul of Taq (~7
units /ul), 37.75 ul of H2O) and 46 ul added to 5 ul
diluted ligation mixture. DNA fragments were amplified
by PCR using the following program: 70 °C for 2 minutes,
94°C for 30 seconds, 56°C for 30 seconds, 72°C for 2
minutes, return to step two 19 times, then 60°C for 30
minutes, and ending in a 4°C hold.
AFLP
Amplification:
For
AFLP analysis preamplified DNA was diluted 1:20 with 1X
TE buffer, 5.0 ul was combined with an AFLP cocktail
(0.5 ul formamide, 2.5 ul 10X AFLP Buffer, 0.3 ul 100 mM
dNTP's , 5 pmole Wellred dye™ (Beckman-Coulter) Labeled
EcoRI specific primer, 25pmole MSE 1 primer, 0.25 ul Taq,
15.35 ul water). The primer sequences (Eco RI
primer: 5’AGA CTG CGT ACC AAT TCAXX 3’) (Mse I
primer: 5’GAT GAG TCC TGA GTA ACXX3”) used for
amplification contain the one base extension just as the
preamplification primer as well as a two base extension
that is specified by the user. The preamplified DNA was
selectively amplified by the following program: 94°C for
2 minutes, 94°C 30 sec, 65°C for 30 seconds reducing by
1°C per cycle, 72°C for 2 minutes, return to step 2 for
9 more times, 94°C for 30 seconds, 72°C for 2 minutes,
return to step 6 for 35 more times, 60°C for 30 minutes,
and 4°C hold.
The
AFLP amplification selects for fragments that contain
specified bases next to the restriction site sequence.
For example, bases that contain 5’ACC3’ on the Eco
RI side of the fragment and 5’CCT3’ on the Mse I
side of the fragment will be amplified. This step
further reduces the number of fragments visualized
during capillary gel electrophoresis. The
preamplification and AFLP amplification step are
performed separately to increase the selectivity of the
primers. In the studies by Vos et al., 1995, the amount
of background smears was decreased in the fingerprint
patterns, and bands were absent when the
preamplification step was dismissed. These bands were
otherwise present when both the preamplification and the
AFLP amplification were performed. It was also found
that primers with a three base extension show a
decreased amount of base mismatching by the sequence
adjacent to the restriction site during PCR in
comparison to using four base extension primers. (Vos et
al., 1995).
Preparation of samples for fragment detection:
The
AFLP amplified DNA was diluted 1:10 in water and 2 ul
was transferred to a well in a sample plate along with a
23 ul of a mixture containing formamide (23 ul) and a
600 base pair dye labeled Size Standard (0.2 ul). A
drop of mineral oil was added to the top of each
sample. Another tray was filled with 1.1 X ACE
Separation Buffer that corresponded with the filled
wells in the sample plate.
Fragment Analysis:
The
samples were run on the Beckman CEQ 8000 Genetic
Analysis System and analyzed with the AFLP analysis
software. The CEQ computer software analyzes the
fragments by detecting the length in comparison to a 600
base pair size standard, and assigns a “1” if the
fragment is present or a “0” if the fragment is absent.
Data generated from all primer pair analysis were
combined and transferred to McClade 3.06 for formatting
and editing. The genetic structure of all populations
were determines by analysis with PAUP (Swofford, 2002).
Parsimony analysis was performed using PAUP with 100
heuristic searches, each with random input order to
produce the shortest tree.
Micro-satellite analysis
Unmodified DNA isolated from each individual plant was
used in a standard PCR reaction using primers specific
for each PVSSR locus used in this study. PCR
optimization reactions were performed to determine the
optimal annealing temperature of each of the PCR
reactions. A standard 25 ul assay was developed which
contained 50 mM KCl, 10mM Tris-HCl pH 9.0 @ 25C, 1.5 mM
MgCl2, 200 um dNTPs, 0.5 um each primer, 100 ng of DNA
template, and 1 unit of taq DNA polymerase. Samples
were placed in a 200 ul well of a 96 x 200 ul PCR
plate. PCR plates were covered with adhesive film and
amplified in a Biometra T Gradient Thermocycler with
heated lid. The amplification program used for all
primer pairs was 94 C for 1 min, 56 C for 2 min, and 72
C for 2 min. This cycle was repeated for 29 more cycles
followed by an extension of 72 C for 5 min. DNA
amplification products were analyzed on 1.5 % agarose
gels containing ethidium bromide with a 100 BP ladder
(neb) used as a molecular weight standard. Digital
images of gels were taken using a COHU high performance
CCD camera connected to a Macintosh Quadra 840av and NIH
Image capturing program. Kodak 1D software was used to
analyze the digital images of the gels.
Results
AFLP
Analysis
94
DNA samples including 5 samples of DNA isolated from
individual plants of the commercial cultivars A (Alamo),
B (Blackwell), CR (Cave-In-Rock), F (Forestburg), K (Kanlow),
and P (Pathfinder) as well as samples from seven
locations of populations derived from the Neal Smith
National Wildlife Refuge were simultaneously analyzed By
AFLP analysis. Two different primer pairs EAAAMCCC and
EAAAMCGC were used on these templates and fragments
collected. For the EAAAMCCC 249 characters (DNA
fragments ranging in size from 60 to 680 base pairs)
were recorded. This data was exported to excel and
formatted with McClade and analyzed using Paup©
phylogenetic software. A phylogentic tree derived from
these data is presented in figure1.

Figure 1. Phylogenetic analysis of switchgrass
populations from the Neal Smith National Wildlife
Reserve and commercial cultivars. The samples were
identified in the following manner:
PLC2
- Plantings in parking lot plantings, PLC - Prairie
Learning Center, S10 - Planting Site 10, MAM - Maminka
Prairie, WL - NRCS adjacency, RL - Roman's Lake, CF -
Badger Digs, A (Alamo), B (Blackwell), CR
(Cave-In-Rock), F (Forestburg), K (Kanlow), and P
(Pathfinder)
From
this data it can be seen that there are a few
individuals of the plants collected at the NSNWR that
are closely related to one of the commercial cultivars.
However most individuals cluster with the group that
they are derived.
Micro-satellite characterization:
Primers which amplify ten microsattelite loci were used
to characterize individual plants collected from the
NSNWR. A list of the loci, the primer sequences used
to amplify the loci, the DNA repeat motif, and the size
of the fragment most often amplified by the primers
listed are found in Table 1.
Table 1
PVSSR loci used in this study
|
Locus |
Primer sequences |
Repeat motif |
Most common fragment |
|
PVSSR018 |
GTGAACTCGGTTGGACCCTA
GGCCCTTCTCCTTTGGTTT |
[CAT]5 |
189 |
|
PVSSR026 |
GCCCAAAAGAATTGAACCAA
CGGGAGAACTACATGCAGAC |
[CCG]5 |
199 |
|
PVSSR051 |
GAGATCGATCGGGAGTGAGA GGGACGAAGAAGAGCTTGAG |
[TTC]4 |
193 |
|
PVSSR064 |
CGTCTACCGGTAATCGAAGG ATAACGGCTGGCACTGAAAG |
[GC]4* |
209 |
|
PVSSR083 |
ACGCCCATCACATTCACAT CGTGCTCAGTGCTTAATGCT |
[AG]4 |
230 |
|
PVSSR084 |
GCCTGTTCAAGTACCCGTTC AACCAGAGGAAGACGAAGCA |
[GC]4* |
229 |
|
PVSSR090 |
TGGTTTTCCTCGCGTACTCT CTCTCTCACACACACGCACA |
[CGTG]6 |
197 |
|
PVSSR091 |
TTGCGGTTTTCCGGTTATTA AGTCGCGGAGAGTAGCAGAA |
[CTA]4 |
212 |
|
PVSSR103 |
AGGAATCGGATGTGAAGCTG ACTGATGGCGCCTTGGAC |
[CGG]5 |
265 |
|
PVSSR107 |
GCTGCAGGTGACCTACGTG TACCAGCAGACGACGAAGC |
[GCT]5 |
217 |
Usually
one expects to amplify fragments that are about the size
of the cloned sequences originally characterized.
However we observed a great deal of variation in the
amplification patterns provided by these ten primer
pairs when applied to the switchgrass samples of the
NSNWR. The most common alleles were about the size
expected but the PCR amplifications quite unexpectedly
produced DNA products that were much larger from many
DNA samples. Table 2 lists the loci characterized and
the most frequently observed fragments produced by PCR.
Table 2 Most common PCR products produced from
NSNWR Switchgrass samples
|
Locus |
PCR band sizes produced (in Base
Pairs) |
|
Pvssr 18 |
193, 220, 250,300, 322, 471, 630 900 |
|
Pvssr 26 |
227, 245, 254, 300 , 390, 437, 640 |
|
Pvssr 51 |
106, 220, 250, 300, 340, 400,450,470 |
|
Pvssr 64 |
190, 200, 250, 320, 387, 480 |
|
Pvssr 83 |
216, 225, 233, 260, 275, 311,337, 550, 600 |
|
Pvssr 84 |
107, 254, 280, 380, 462, 640, 960 |
|
Pvssr 90 |
126, 143, 200, 220, 242, 260, 290, 311, 344, 440,
550, 650, 760, 800 |
|
Pvssr 91 |
220, 230, 240 ,337, 442, 450, 560, 680, 850, 1100,
1471 |
|
Pvssr 103 |
128, 135, 142, 150, 157, 250, 271, 281, 377, 400,
500, 933 |
|
Pvssr 107 |
93, 193, 200, 233, 244, 277, 289, 300, 433, 450,
550, 700, 750, 800, 933,1245, 1698 |
Although not listed here many individual plant DNA
samples could be distinguished by the amplification
patterns provided by these 10 loci. Many of the DNA
samples however gave no amplification product so it is
not possible to do a definitive identification at this
time using these primers. The lack of amplification of
samples is probably due to the low concentration of the
templates from these samples. DNA of better quality can
be obtained from new sprouts than from mature seed
bearing plants as were provided for this study.
Discussion
DNA
was isolated from individual plants from seven locations
on or near the Neal Smith National Wildlife Refuge. The
genetic diversity of these samples was assessed by
Fluorescent AFLP analysis and by micro-satellite
analysis using loci previously characterized by Lee
Gunter. AFLP analysis of the refuge grown samples
was compared directly to commercial cultivar genomes.
Micro-satellite analysis of the cultivar DNA was not
done due to the lack of sufficient quantity of template
DNA. Aflp analysis is useful for determining genetic
relatedness of populations and can be used with small
amounts of DNA. Once templates are made a number of
analysis on the samples can be run. Micro-satellites on
the other hand produce unique fragments from nearly
every plant analyzed but requires more DNA to do the
analysis. It is possible that the micro-satellite loci
can be used to forensically type individual plants.
This ability would be useful in the study of the
vegetative propagation of clonal species.
LITERATURE CITED:
Boom, R. et al. (1990) Rapid and simple methods for
purification of nucleic acids. Journal of
Clinical Microbiology.
28 (3): 495-503.
Hilker, C. A. (2002) The use of AFLP to detect Genetic
Differentiation within and among populations of Two
Prairie Plant Species: Panicum virgatum and Coreopsis
Palmata. M.S. thesis University of Northern Iowa 122 pp.
Soltis and Gitzendamner, M. (2002) Soltis Lab AFLP
Protocol.
Swofford, D.L. 2002. PAUP*. Phylogenetic Analysis
Using Parsimony (*and Other Methods).
Version 4.0b 10. Sinauer Associates, Sunderland,
Massachusetts.
Vos,
Pieter, et al. (1995) AFLP: a new technique for DNA
fingerprinting. Nucleic Acids
Research
23(21), 4407-441).
|
|